View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20695_low_17 (Length: 283)
Name: NF20695_low_17
Description: NF20695
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20695_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 13 - 270
Target Start/End: Original strand, 29144495 - 29144756
Alignment:
| Q |
13 |
gagaacaacacgtaatgaaagtaaacaacaaaaccattgaaatgctgacacaaactagttctcctctaatgcatagcacctgtcaccaaatatctttann |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29144495 |
gagaacaacacgtaatgaaagtaaacaacaaaaccattgaaatgctgacacaaactagttctcctctaatgcatagcacctgtcaccaaatatctttatt |
29144594 |
T |
 |
| Q |
113 |
nnnnnnnnc---aatttatttgcagcatttatttctacaactgacttttgtttttatcatagcaaaactattcaaataccaagccaaataattatggcct |
209 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29144595 |
ttttttttcttcaatttatttgcagcatttatttctacaactgacttttgtttttatcatagcaaaactattcaaataccaagccaaataattatggcct |
29144694 |
T |
 |
| Q |
210 |
cgatcttata-ttgacctcttaatttcttgagttgagttgagcacagcacatatagtttttg |
270 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29144695 |
cgatcttatatttgacctcttaatttcttgagttgagctgagcacagcacatatagtttttg |
29144756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University