View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20695_low_19 (Length: 278)
Name: NF20695_low_19
Description: NF20695
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20695_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 255; Significance: 1e-142; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 1 - 259
Target Start/End: Complemental strand, 24214038 - 24213780
Alignment:
| Q |
1 |
cattaacacagactcaaacagcacagttttaagctgtgcagtacatattccacttctactagtcatcatcaatatagatagtctcttgcttgaacaggcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24214038 |
cattaacacagactcaaacagcacagttttaagctgtgcagtacatattccacttctactagtcatcatcaatatagatagtctcttgcttgaacaggcc |
24213939 |
T |
 |
| Q |
101 |
accaaataccttcctaacctccttcggtttctcttctatctttcttttttcctcctttggtttactcacactgtttcttggagttgttgtttgtttagtc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24213938 |
accaaataccttcctaacctccttcggtttctcttctatctttcttttttcctcctttggtttactcacactgtttcttggagttgttgtttgtttagtc |
24213839 |
T |
 |
| Q |
201 |
acagctttgttaggaatgagactccgagccttcgcctgtcctcttatggtagcaacttg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
24213838 |
acagctttgttaggaatgagactccgagccttcgcctgtcctcttacggtagcaacttg |
24213780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 205 - 259
Target Start/End: Original strand, 8758122 - 8758176
Alignment:
| Q |
205 |
ctttgttaggaatgagactccgagccttcgcctgtcctcttatggtagcaacttg |
259 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| ||| |||||||| |
|
|
| T |
8758122 |
ctttgttaggaatgagactccgagctttcgcctgtcctcttacggtggcaacttg |
8758176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 213 - 259
Target Start/End: Complemental strand, 41878907 - 41878861
Alignment:
| Q |
213 |
ggaatgagactccgagccttcgcctgtcctcttatggtagcaacttg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
41878907 |
ggaatgagactccgagccttcgcctgtcctcttacggtggcaacttg |
41878861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University