View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20695_low_24 (Length: 249)
Name: NF20695_low_24
Description: NF20695
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20695_low_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 1 - 162
Target Start/End: Complemental strand, 37268725 - 37268562
Alignment:
| Q |
1 |
tataataataaaaagaccaccatgcttccctcgtgttgtgtacttgtgttcgagtgaatcagaaattnnnnnnnnnnngaa--ccacgaattaaaaattg |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
37268725 |
tataataataaaaagaccaccatgcttccctcgtgttgtgtacttgtgttcgagtgaatcagaaattaaaaaaaaaaaaaaaaccacgaattaaaaattg |
37268626 |
T |
|
| Q |
99 |
ggacaatgtaaaattttgctaagcatgtttaataataaatactagtacaagtaacaatcaaaag |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37268625 |
ggacaatgtaaaattttgctaagcatgtttaataataaatactagtacaagtaacaatcaaaag |
37268562 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University