View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20696_low_4 (Length: 344)
Name: NF20696_low_4
Description: NF20696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20696_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 229; Significance: 1e-126; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 95 - 323
Target Start/End: Complemental strand, 3894481 - 3894253
Alignment:
| Q |
95 |
ttaaattgctattactgccattcaattgttgcagttatactgtgggtgaccaatgtgattgtgcactgaaataaatgatgaagttaacttacgtctgatt |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3894481 |
ttaaattgctattactgccattcaattgttgcagttatactgtgggtgaccaatgtgattgtgcactgaaataaatgatgaagttaacttacgtctgatt |
3894382 |
T |
|
| Q |
195 |
ggttggaagcagaagcaacgaagactctggagggtttaggaagggggagtgaaggtacgctagggaatgcctttgagaaccggaagattgcgtttctagt |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3894381 |
ggttggaagcagaagcaacgaagactctggagggtttaggaagggggagtgaaggtacgctagggaatgcctttgagaaccggaagattgcgtttctagt |
3894282 |
T |
|
| Q |
295 |
gatgaacattgctgccatgtttctttcta |
323 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
3894281 |
gatgaacattgctgccatgtttctttcta |
3894253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 20 - 103
Target Start/End: Original strand, 3894462 - 3894545
Alignment:
| Q |
20 |
tggcagtaatagcaatttaaaattgttatgttgcaactatgattttagattactcacatagttgcattggtacaattaaattgc |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3894462 |
tggcagtaatagcaatttaaaattgttatgttgcaactatgattttagattactcacatagttgcattggtacaattaaattgc |
3894545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University