View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20696_low_5 (Length: 214)
Name: NF20696_low_5
Description: NF20696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20696_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 15 - 197
Target Start/End: Complemental strand, 44730737 - 44730555
Alignment:
| Q |
15 |
ttatacttgtgcagttatcaatacaatgaaaaatattaagaggacatcttatagttcactgttcttctgtgctcttttgtttgcttttctaattgtgaga |
114 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44730737 |
ttatacttgtgcatttatcaatacaatgaaaaatattaagaggacatcttatagttcactgttcttctgtgctcttttgtttgcttttctaattgtgaga |
44730638 |
T |
|
| Q |
115 |
taccacaaatcttgtttgtaacttacaagggatctcacgaagtgtttcttgtaagtattggattttggcaaactcaaaacttg |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
44730637 |
taccacaaatcttgtttgtaacttacaagggatctcacgaagtgtttcttgtaagcattggattttggcaaactcaaaacttg |
44730555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 15 - 80
Target Start/End: Original strand, 8899678 - 8899742
Alignment:
| Q |
15 |
ttatacttgtgcagttatcaatacaatgaaaaatattaagaggacatcttatagttcactgttctt |
80 |
Q |
| |
|
||||||||||||| |||||||||||||| || |||||||||| | |||||| ||||||| ||||| |
|
|
| T |
8899678 |
ttatacttgtgcatttatcaatacaatg-aagatattaagagtaaatcttactgttcacttttctt |
8899742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University