View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20698_high_11 (Length: 272)
Name: NF20698_high_11
Description: NF20698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20698_high_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 240; Significance: 1e-133; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 256
Target Start/End: Complemental strand, 12616366 - 12616111
Alignment:
| Q |
1 |
ttatacttattgacctaccaatgatagacctatcagctgaaaaatcaatggtaataaaactcatagtaaaagcttgtgaagaatatggtttcttcaatgt |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12616366 |
ttatacctattgacctaccaatgatagacctatcagctgaaaaatcaatggtaataaaactcatagtaaaagcttgtgaagaatatggtttcttcaatgt |
12616267 |
T |
|
| Q |
101 |
gattaaccatggtgtcccttatgacatcatatccaaaatggaagaagtaggttttgatttctttgcaaaaccaatggaacaaaagaaactagttgcacct |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
12616266 |
gattaaccatggtgtccctcatgacatcatatccaaaatggaagaagtaggttttgatttctttgcaaaaccaatggaacaaaagaaactagttgcactt |
12616167 |
T |
|
| Q |
201 |
ggtaatccctatggttatggatgcaagaatattgggttcaatggagacatgggtga |
256 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12616166 |
ggtaatccctttggttatggatgcaagaatattgggttcaatggagacatgggtga |
12616111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 60 - 112
Target Start/End: Complemental strand, 29878124 - 29878072
Alignment:
| Q |
60 |
ctcatagtaaaagcttgtgaagaatatggtttcttcaatgtgattaaccatgg |
112 |
Q |
| |
|
||||||||||||||||||||||| | ||| |||||||| || || |||||||| |
|
|
| T |
29878124 |
ctcatagtaaaagcttgtgaagattttggattcttcaaagtcataaaccatgg |
29878072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University