View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20698_high_17 (Length: 236)
Name: NF20698_high_17
Description: NF20698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20698_high_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 4996577 - 4996793
Alignment:
| Q |
1 |
ttcatcattgattgcacacttttctccataataatcccnnnnnnnncaagaccttttttgttactatcttcaagttcaacaactaaagtgaatcttgtga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4996577 |
ttcatcattgattgcacacttttctccataataatcccaaaaaat-caagaccttttttgttactatcttcaagttcaacaactaaagtgaatcttgtga |
4996675 |
T |
|
| Q |
101 |
actgtctctatcttcatgcatgaataagaggagcttctacttattcacgaggaaaatcactaagaagtgtgtgacgcatactaccaaacttcagcatctt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
4996676 |
actgtctctatcttcatgcatgaataagaggagcttctacttattcacgaggaaaatcactaagaagtgtgtgactcatactaccaaactttagcatctt |
4996775 |
T |
|
| Q |
201 |
caactatacaaatacaaa |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
4996776 |
caactatacaaatacaaa |
4996793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University