View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20698_high_6 (Length: 304)
Name: NF20698_high_6
Description: NF20698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20698_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 16 - 286
Target Start/End: Original strand, 51552910 - 51553180
Alignment:
| Q |
16 |
ataaaaagtgatttttaatcattgaaaatatattgtattgatgaattattttgctgtgtatacagtggtgctaggagaaggatttttgggtctagcaatg |
115 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51552910 |
ataaaaagtgatttttaatcattcaaaatatattgtattgatgaattattttgctgtgtatacagtggtgctaggagaaggatttttgggtctagcaatg |
51553009 |
T |
 |
| Q |
116 |
ggattcagaaacacagctggtcctgaaggacatcaagcagtagcagctagagtccaagcagatcgtgctgtgtttgccaactgccgttttgaaggcttcc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51553010 |
ggattcagaaacacagctggtcctgaaggacatcaagcagtagcagctagagtccaagcagatcgtgctgtgtttgccaactgccgttttgaaggcttcc |
51553109 |
T |
 |
| Q |
216 |
aagacacgctatacacagtagcacatagacaattcttccgtagctgcatcataacaggaacaatcgatttc |
286 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51553110 |
aagacacgctatacacagtggcacatagacaattcttccgtagctgcatcataacaggaacaatcgatttc |
51553180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University