View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20699_low_18 (Length: 248)
Name: NF20699_low_18
Description: NF20699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20699_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 105; Significance: 1e-52; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 1 - 105
Target Start/End: Original strand, 40595471 - 40595575
Alignment:
| Q |
1 |
agagagtgatacataaccaatttatttatctttgcaacttaaccttgtcagaaattaaaacttgctactttttgcagtgcacacaacagcataaaggcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40595471 |
agagagtgatacataaccaatttatttatctttgcaacttaaccttgtcagaaattaaaacttgctactttttgcagtgcacacaacagcataaaggcat |
40595570 |
T |
 |
| Q |
101 |
ttggc |
105 |
Q |
| |
|
||||| |
|
|
| T |
40595571 |
ttggc |
40595575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 146 - 233
Target Start/End: Original strand, 40595608 - 40595695
Alignment:
| Q |
146 |
tctgagacagacattatttgatgcaaaataaatagtcatagaagcaaattattaaactagatttatatagaaagtagtaagaaaatca |
233 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40595608 |
tctgagacagacattatttaatgcaaaataaatagtcatagaagcaaatcattaaactagatttatatagaaagtagtaagaaaatca |
40595695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 115 - 148
Target Start/End: Original strand, 40595437 - 40595470
Alignment:
| Q |
115 |
atgcaaagatataatttgtttcctcatgctctct |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
40595437 |
atgcaaagatataatttgtttcctcatgctctct |
40595470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University