View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20700_high_3 (Length: 255)
Name: NF20700_high_3
Description: NF20700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20700_high_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 47918663 - 47918429
Alignment:
| Q |
1 |
atacataaaaactctttcacttcagatagaattggacagaaataaacgtg-agaaaatggaaagnnnnnnntataatcttgatttatattactaatactc |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| | | |||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
47918663 |
atacataaaaactctttcacttcagatagaattggacagaaataaatatacataaaa---aaa--------tataatcttgatttatattactaatactc |
47918575 |
T |
 |
| Q |
100 |
tgactgcaattttttataatatcatagattgcagcagcaatttcaaaagcttaattagtacctgaattatgccggaatggtcaccctttgagtgcttttc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47918574 |
tgactgcaattttttataatatcatagattgcagcagcaatttcaaaagcttaattagtacctgaattatgccggaatggtcaccctttgagtgcttttc |
47918475 |
T |
 |
| Q |
200 |
gaacctttataggctcaacaggttcatctcccctattttgtctctg |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47918474 |
gaacctttataggctcaacaggttcatctcccctattttgtctctg |
47918429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 67; Significance: 7e-30; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 1 - 195
Target Start/End: Original strand, 29918501 - 29918694
Alignment:
| Q |
1 |
atacataaaaactctttcacttcagatagaattggacagaaataaacgtgagaaaatggaaagnnnnnnntataatcttgatttatattactaatactct |
100 |
Q |
| |
|
||||||||||| |||| ||||||| ||||||||||||| ||||| ||||||||||||||| | |||||||||||||||||||||| |||| |
|
|
| T |
29918501 |
atacataaaaagtctt-cacttcacatagaattggacataaataggtgtgagaaaatggaaa---ataatttgaatcttgatttatattactaattctct |
29918596 |
T |
 |
| Q |
101 |
gactgcaattttttataatatcatagattgcagcagcaatttcaaaagct---taattagtacctgaattatgccggaatggtcaccctttgagtgct |
195 |
Q |
| |
|
|||| | ||||||||||| |||||||| |||||||||||||||||| | || ||||||||||||||||||| | |||||||||| ||||||||| |
|
|
| T |
29918597 |
aactgaatttttttataatttcatagatcacagcagcaatttcaaaagtttagtacttagtacctgaattatgccagcatggtcaccccttgagtgct |
29918694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 192 - 245
Target Start/End: Original strand, 29918750 - 29918803
Alignment:
| Q |
192 |
tgcttttcgaacctttataggctcaacaggttcatctcccctattttgtctctg |
245 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
29918750 |
tgctttttgaacctttataggctcaacaggttcatcacccctattttgtctctg |
29918803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University