View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20701_low_17 (Length: 236)
Name: NF20701_low_17
Description: NF20701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20701_low_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 29667229 - 29667448
Alignment:
| Q |
1 |
tgcctttccctttcttggctcacaagcaagggttctacactgtcacgtgccaccctaaaaaccttgaacacattctccgaaccaggtttgataattaccc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
29667229 |
tgcctttccctttcttggctcacaagcaagggttctacactgtcacgtgccaccctaaaaaccttgaacacattctccgaacccggtttgataattaccc |
29667328 |
T |
|
| Q |
101 |
gaaaggacctaagtggcaaaccgcatttcatgatcttttgggccaaggcattttcaacagtgacggtgaaacatggataatgcaacgcaaaaccgcggcc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
29667329 |
gaaaggacctaagtggcaaaccgcatttcatgatcttttgggccaaggcattttcaacagtgacggtgaaacatggataatgcaacgtaaaaccgcggcc |
29667428 |
T |
|
| Q |
201 |
ctcgagttcacggcacgaac |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
29667429 |
ctcgagttcacggcacgaac |
29667448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 27 - 211
Target Start/End: Original strand, 25243128 - 25243312
Alignment:
| Q |
27 |
caagggttctacactgtcacgtgccaccctaaaaaccttgaacacattctccgaaccaggtttgataattacccgaaaggacctaagtggcaaaccgcat |
126 |
Q |
| |
|
||||| |||||||| ||||| | ||||| |||||| ||||||| || ||||||||| |||| ||||||||||| |||||||| | ||||||||||| | |
|
|
| T |
25243128 |
caaggcttctacacagtcacaagtcacccaaaaaacattgaacatatcctccgaacccggttcgataattacccaaaaggaccaacatggcaaaccgctt |
25243227 |
T |
|
| Q |
127 |
ttcatgatcttttgggccaaggcattttcaacagtgacggtgaaacatggataatgcaacgcaaaaccgcggccctcgagttcac |
211 |
Q |
| |
|
| ||||||||||| || || || || |||||||| || ||||| || ||| | | ||||| |||||||| || ||||| ||||| |
|
|
| T |
25243228 |
tccatgatcttttaggacacggaatcttcaacagcgatggtgacacgtggctggttcaacgtaaaaccgctgcactcgaattcac |
25243312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University