View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20701_low_3 (Length: 452)
Name: NF20701_low_3
Description: NF20701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20701_low_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 391; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 391; E-Value: 0
Query Start/End: Original strand, 6 - 436
Target Start/End: Original strand, 136666 - 137095
Alignment:
| Q |
6 |
agcagcacagatgaaaatcatatctccaacaattcagatgccactttagagctcaactccaatatctctcttccttatcattgggaacaatgccttgacc |
105 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
136666 |
agcagctcagatgaaaatcatatctccaacaattcagatgccactttagagctcaactccaatatctctcttccttatcattgggaacaatgccttgacc |
136765 |
T |
|
| Q |
106 |
taaaggttcttccactattctcttattcttatctcttcttctttcaaaatttactcacctttgctagttgcatgatgctggatcttttttgttctatctc |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
136766 |
taaaggttcttccactattctcttattcttatctcttcttctttcaaaatttactca-ctttgctagttgcatgatgctggatcttttttgttctatctc |
136864 |
T |
|
| Q |
206 |
tttggtctttttaatttaattaatatgctttctaattccaataataagaacagcattccaggcacgctagctacagtaactgacnnnnnnnnccctagaa |
305 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
136865 |
tttggtctttttaatttaattaatatgttttctaattccaataataagaacagcattccaggcacgctagctacagtaactgacaaaaaaaaccctagaa |
136964 |
T |
|
| Q |
306 |
aaataaagtagtagtagtatagtggtgttttgctttttacattctcaaatattctcacttcttttcatttaacttttcctttatagggtaaggtgcaatg |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
136965 |
aaataaagtagtagtagtatagtggtgttttgctttttacattctcaaatattctcacttcttttcatttaacttttcctttatagggtaaggtgcaatg |
137064 |
T |
|
| Q |
406 |
caacttttcttggtttctgttgttgaatttg |
436 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
137065 |
caacttttcttggtttctgttgttgaatttg |
137095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University