View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20702_high_26 (Length: 252)
Name: NF20702_high_26
Description: NF20702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20702_high_26 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 96 - 245
Target Start/End: Complemental strand, 33432649 - 33432500
Alignment:
| Q |
96 |
gttggaaaaagagccggtttcttttgattacatagaatggataatcaggaacgaactgtatcctctccctattcttgctaaaaatgcctttgccaccact |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33432649 |
gttggaaaaagagccggtttcttttgattacatagaatggataatcaggaacgaactgtatcctctccctattcttgctaaaaatgcctttgccaccact |
33432550 |
T |
|
| Q |
196 |
caagaggtatatgtcatttttccattttttatattgctttagaattatct |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33432549 |
caagaggtatatgtcatttttccattttttatattgctttagaattatct |
33432500 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 33432744 - 33432701
Alignment:
| Q |
1 |
cactcaaaccataagtaagcacattaaattaatcacttaattga |
44 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33432744 |
cactcaaaccataagtaagcacattaaattaatcacttaattga |
33432701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 101 - 156
Target Start/End: Original strand, 33966840 - 33966895
Alignment:
| Q |
101 |
aaaaagagccggtttcttttgattacatagaatggataatcaggaacgaactgtat |
156 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||| ||||||||||| ||||| |
|
|
| T |
33966840 |
aaaaagagccgctttcttttgattacatagaaaggatactcaggaacgaaatgtat |
33966895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University