View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20702_high_31 (Length: 234)
Name: NF20702_high_31
Description: NF20702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20702_high_31 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 74 - 234
Target Start/End: Complemental strand, 42293464 - 42293304
Alignment:
| Q |
74 |
aataattaacttagataacaccttaacccaggcatgccgttgatatcattgttcctaggacaatttatttatttaacttccaaagtagtagtatattaag |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
42293464 |
aataattaacttagataacaccttaacccaggcatgccgttgatatcattgttcctaggacaatttatttatttaacttccaaagtagtagtatatcaag |
42293365 |
T |
 |
| Q |
174 |
ctttacaagcggggttagaggaaaggcttgttagccaaacagagtcactaacaacaggttc |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42293364 |
ctttacaagcggggttagaggaaaggcttgttagccaaacagagtcactaacaacaggttc |
42293304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 15 - 53
Target Start/End: Complemental strand, 42293504 - 42293466
Alignment:
| Q |
15 |
gtaactgcaccgaaagatatttataatattatttgttga |
53 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42293504 |
gtaactgcaccgaaagatatttataatattatttgttga |
42293466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University