View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20703_low_2 (Length: 258)
Name: NF20703_low_2
Description: NF20703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20703_low_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 14 - 241
Target Start/End: Original strand, 47892941 - 47893168
Alignment:
| Q |
14 |
agatggctaagaggggggcatggctatataatagatgaaccgtagacgacaaattagcattaattgctagaaaagtactatttccgtcttatattttagt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47892941 |
agatggctaagaggggggcatggctatataatagatgaaccgtagacgacaaattagcattaattgctagaaaagtactatttccgtcttatattttagt |
47893040 |
T |
|
| Q |
114 |
ataatttagattatctaatctacannnnnnnaataaaattattaaatggattaagatagtatcatatcaaggtattagtnnnnnnnntgtgattaaannn |
213 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
47893041 |
ataatttagattatctaatctacatttttttaataaaattattaaatggattaagatagtatcatatcaaggtattagtaaaaaaaatgtgattaaattt |
47893140 |
T |
|
| Q |
214 |
nnnnagtattttaaaataacaaataatt |
241 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
47893141 |
ttttagtattttaaaataacaaataatt |
47893168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University