View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20704_high_10 (Length: 274)
Name: NF20704_high_10
Description: NF20704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20704_high_10 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 62 - 274
Target Start/End: Complemental strand, 21483434 - 21483222
Alignment:
| Q |
62 |
caacaatgtgctacaacctcatggtatgaattttggaggttatggaaatcaatataattcttatcagttgtttcctggtcctggtgataggttgatgagg |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21483434 |
caacaatgtgctacaacctcatggtatgaattttggaggttatggaaatcaatataattcttatcagttgtttcctggtcctggtgataggttgatgagg |
21483335 |
T |
 |
| Q |
162 |
ttaggtccttctgctacaaaagaagctagaaagaagaggatggctcggcaacggcggtttatgtctcatcataggcatcataataataaacatcatcaga |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
21483334 |
ttaggtccttctgctacaaaagaagctagaaagaagaggatggctcggcaacggcggtttatgtctcatcataggcatcataatattaaccatcatcaga |
21483235 |
T |
 |
| Q |
262 |
atattcaaggttc |
274 |
Q |
| |
|
||||||||||||| |
|
|
| T |
21483234 |
atattcaaggttc |
21483222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 21483448 - 21483513
Alignment:
| Q |
1 |
atgattgattgtagtttggtgcaacattgaattgagaagcaccccatgaatgatttgattccaaca |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21483448 |
atgattgattgtagtttggtgcaacattgaattgagaagcaccccatgaatgatttgattccaaca |
21483513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University