View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20704_high_5 (Length: 493)
Name: NF20704_high_5
Description: NF20704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20704_high_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 430; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 430; E-Value: 0
Query Start/End: Original strand, 22 - 483
Target Start/End: Original strand, 21482804 - 21483265
Alignment:
| Q |
22 |
gcagagacctttaaagccattatattgcagccacaattacggttgttgaccataatttaaaacttattcaagttcaataacaaatgattttgcattaaca |
121 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
21482804 |
gcagagacctttaaaaccattatattgcagccacaattacggttgttgaccataatttaaaacttattcaagttcaataacaaatgattttgcatttaca |
21482903 |
T |
|
| Q |
122 |
tgcatttctaataatcacacatcgtagatcatataaacaaccaaaacatatgatctaacaataatatacagcttaagtccacaaacctgtctcctatcgg |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
21482904 |
tgcatttctaataatcacacatcgtagatcatataaacaaccaaaacatataatctaacaataatataaagctgaagtccacaaacctgtctcctatcgg |
21483003 |
T |
|
| Q |
222 |
atgcacttcgaccctggtgagaactctgtgtctgcatggtggggcggtcacggtccactggaggctgcgtcggctcagccggaacaacaggtgccaagga |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21483004 |
atgcacttcgaccctggtgagaactctgtgtctgcatggtggggcggtcacggtccactggaggctgcgtcggctcagccggaacaacaggtgccaagga |
21483103 |
T |
|
| Q |
322 |
agctgctgtcccaccggtcatagtctgccaatacatccagttcgctggatttgcatgagaaccaccagcagcaacattggtgcaattatcaccactacct |
421 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
21483104 |
ggctgctgtcccaccggtcatagtctgccaatacatccagttcgctggatttgcatgagaaccaccagcagcaacattggtgcaactatcaccactacct |
21483203 |
T |
|
| Q |
422 |
aatctcgcaagtggatcagaaccttgaatattctgatgatggttattattatgatgcctatg |
483 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
21483204 |
aatctcgcaagtggatcagaaccttgaatattctgatgatggttaatattatgatgcctatg |
21483265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 41 - 85
Target Start/End: Original strand, 21490752 - 21490796
Alignment:
| Q |
41 |
ttatattgcagccacaattacggttgttgaccataatttaaaact |
85 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
21490752 |
ttatatcgcagccacaattacggttgcagaccaaaatttaaaact |
21490796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University