View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20704_low_14 (Length: 211)

Name: NF20704_low_14
Description: NF20704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20704_low_14
NF20704_low_14
[»] scaffold0013 (1 HSPs)
scaffold0013 (70-181)||(90712-90823)
[»] chr4 (2 HSPs)
chr4 (70-180)||(105949-106059)
chr4 (75-152)||(166514-166591)
[»] chr7 (1 HSPs)
chr7 (70-157)||(13054449-13054536)
[»] chr8 (3 HSPs)
chr8 (75-155)||(5687384-5687464)
chr8 (75-155)||(5719500-5719580)
chr8 (75-155)||(5666314-5666394)


Alignment Details
Target: scaffold0013 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: scaffold0013
Description:

Target: scaffold0013; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 70 - 181
Target Start/End: Original strand, 90712 - 90823
Alignment:
70 ttatgaacctttttagggcatgaaagatagctctctccccaaccaccgtcgtttctttgtattgtgagaagaaatttaacagctttacaaatagcatcgc 169  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |    
90712 ttatgaacctttttagggcatgaaagatagctctctccccaaccaccgtcgtttctttgtattgtgagaagaaatttaacagctttacgaatagcatcac 90811  T
170 aattagtataat 181  Q
    ||||||||||||    
90812 aattagtataat 90823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 59; Significance: 3e-25; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 70 - 180
Target Start/End: Complemental strand, 106059 - 105949
Alignment:
70 ttatgaacctttttagggcatgaaagatagctctctccccaaccaccgtcgtttctttgtattgtgagaagaaatttaacagctttacaaatagcatcgc 169  Q
    |||||||||||||| |||| ||||||||||||||| ||||| ||||| || | ||| ||| ||||||||||||||||||||||||| | ||||||| |||    
106059 ttatgaaccttttttgggcttgaaagatagctctccccccacccaccatcctctctctgtgttgtgagaagaaatttaacagctttgcgaatagcagcgc 105960  T
170 aattagtataa 180  Q
    |||| ||||||    
105959 aattggtataa 105949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 75 - 152
Target Start/End: Complemental strand, 166591 - 166514
Alignment:
75 aacctttttagggcatgaaagatagctctctccccaaccaccgtcgtttctttgtattgtgagaagaaatttaacagc 152  Q
    ||||||||| |||||||||||||||||||| ||||| ||||| || ||||  |||||| | |||||||||||||||||    
166591 aaccttttttgggcatgaaagatagctctccccccacccaccatcttttccctgtattctcagaagaaatttaacagc 166514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 70 - 157
Target Start/End: Complemental strand, 13054536 - 13054449
Alignment:
70 ttatgaacctttttagggcatgaaagatagctctctccccaaccaccgtcgtttctttgtattgtgagaagaaatttaacagctttac 157  Q
    |||||||||||||| |||||||||||||||||||||||||| ||||| || | ||||||| ||| ||||||||||| |||||||||||    
13054536 ttatgaaccttttttgggcatgaaagatagctctctccccacccaccatcctctctttgtgttgagagaagaaattgaacagctttac 13054449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 45; Significance: 8e-17; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 75 - 155
Target Start/End: Original strand, 5687384 - 5687464
Alignment:
75 aacctttttagggcatgaaagatagctctctccccaaccaccgtcgtttctttgtattgtgagaagaaatttaacagcttt 155  Q
    ||||||||| | ||||||||||| |||||||||||| ||||| || | |||||||||||| || |||||||||||||||||    
5687384 aaccttttttgagcatgaaagatggctctctccccacccaccatcctctctttgtattgtaagcagaaatttaacagcttt 5687464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 75 - 155
Target Start/End: Original strand, 5719500 - 5719580
Alignment:
75 aacctttttagggcatgaaagatagctctctccccaaccaccgtcgtttctttgtattgtgagaagaaatttaacagcttt 155  Q
    ||||||||| | ||||||||||| |||||||||||| ||||| || | |||||||||||| || |||||||||||||||||    
5719500 aaccttttttgagcatgaaagatggctctctccccacccaccatcctctctttgtattgtaagcagaaatttaacagcttt 5719580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 75 - 155
Target Start/End: Original strand, 5666314 - 5666394
Alignment:
75 aacctttttagggcatgaaagatagctctctccccaaccaccgtcgtttctttgtattgtgagaagaaatttaacagcttt 155  Q
    ||||||||| | || |||||||| |||||||||||| ||||| || | |||||||||||| || |||||||||||||||||    
5666314 aaccttttttgagcttgaaagatggctctctccccatccaccatcctctctttgtattgtaagcagaaatttaacagcttt 5666394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University