View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20705_high_13 (Length: 303)
Name: NF20705_high_13
Description: NF20705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20705_high_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 20 - 296
Target Start/End: Original strand, 16010161 - 16010437
Alignment:
| Q |
20 |
gacatcatcagcagcccttgcattcttttgcaacaatggatcaatatctggcaatttaggaatctgagctaatagatcaatggtccttcgaaggagacga |
119 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
16010161 |
gacatcacaagcagcccttgcattcttttgcaacaatggatcaatatctggcaaattaggaatctgagctaatagatcaattgtccttcgaaggagacga |
16010260 |
T |
|
| Q |
120 |
gctagatcaccatcatccattgcacagtccatcattatttctctccatgtcaacccagaagcccaagcttcaaccataccgcaaaactggctatccaaac |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16010261 |
gctagatcaccatcatccattgcacagtccatcattatttctctccatgtcaacccagaagcccaagcttcaaccataccgcaaaactggctatccaaac |
16010360 |
T |
|
| Q |
220 |
agcaagatattgtcaccccatgtttctcctgaattgtcaatagagcatttctttgctcatccaataaccctatgata |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16010361 |
agcaagatattgtcaccccatgtttctcctgaattgtcaatagagcatttctttgctcatccaataaccctatgata |
16010437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University