View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20706_high_35 (Length: 335)
Name: NF20706_high_35
Description: NF20706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20706_high_35 |
 |  |
|
| [»] scaffold0036 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0036 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 17 - 322
Target Start/End: Complemental strand, 6507 - 6206
Alignment:
| Q |
17 |
acatgtttctatcattctttgaagttgtggggtggggtggggttagaaatttagaatcatctctttggttttaaggggctgcattgcccaatttatgtta |
116 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6507 |
acatgtttctatcattctttgaaattgtggggtg-----gggttagaaatttagaatcatctctttggttttaaggggctgcattgcccaatttatgtta |
6413 |
T |
 |
| Q |
117 |
ctgatgctaaaacaatatggataaggtgggatttggtgcatcaca-nnnnnnnnnnnnnnngctaattggtgcatcacattgccttaaggaagctctttc |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
6412 |
ctgatgctaaaacaatatggataaggtgggatttggtgcatcacattttttttttgaaaaagctaattggtgcatcacattgccataaggaagcactttt |
6313 |
T |
 |
| Q |
216 |
attgattggatttggtatgtcttaagtaagcatgttgttatattcatctgtcatatttgttctgnnnnnnncttgttccgttgtatatgctgctgtatga |
315 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6312 |
attgattggatttggtatgtcgtaagtaagcatgttgttatattcatctgtcatatttgttctgtttttttcttgttccgttgtatatgctgctgtatga |
6213 |
T |
 |
| Q |
316 |
tccatct |
322 |
Q |
| |
|
||||||| |
|
|
| T |
6212 |
tccatct |
6206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University