View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20706_high_64 (Length: 242)
Name: NF20706_high_64
Description: NF20706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20706_high_64 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 70 - 205
Target Start/End: Complemental strand, 1250198 - 1250063
Alignment:
| Q |
70 |
ccattgtaaccacatgtgactataaatttaaaacgtcacatgccgaattttaatcaggacatgaatcatgatgatgtgtcatccattaattcctaggtct |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1250198 |
ccattgtaaccacatgtgactataaatttaaaacgtcacatgccgaattttaatcaggacatgaatcatgatgatgtgtcatccattaattcctaggtct |
1250099 |
T |
 |
| Q |
170 |
atattgggaacccaccacaagaattatacaacagtt |
205 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
1250098 |
atattgggaacccaccacaagaataatacaacagtt |
1250063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 1251885 - 1251826
Alignment:
| Q |
1 |
ttttattgtaaagtagttttataaaaaa-gatggtcagataagtagagtaattagtaata |
59 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
1251885 |
ttttattgtaaagtagttttataaaaaaagatggtcagataagtagagtaattagtaata |
1251826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University