View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20706_high_71 (Length: 235)
Name: NF20706_high_71
Description: NF20706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20706_high_71 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 5799335 - 5799119
Alignment:
| Q |
1 |
atgatcagtttgttgttttagccacagatggggtttgggatgttttatccaacaatcaagttgtgaacattgtggcatctgctccacgatcttcggctgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5799335 |
atgatcagtttgttgttttagccacagatggggtttgggatgttttatccaacaatcaagttgtgaacattgtggcatctgctccacgatcttcggctgc |
5799236 |
T |
 |
| Q |
101 |
taaactagttgttgaggcagctgttcaagcatggaagactaaggttccatctaagcctgatgattgctctgcagtttgcctattctttcattcaaacacc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5799235 |
taaactagttgttgaggcagctgttcaagcatggaagactaagattccatctaaacctgatgattgctctgcagtttgcctattctttcattcaaacacc |
5799136 |
T |
 |
| Q |
201 |
aataccaatactcctaa |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
5799135 |
aataccaatactcctaa |
5799119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 34 - 126
Target Start/End: Complemental strand, 6833134 - 6833042
Alignment:
| Q |
34 |
tttgggatgttttatccaacaatcaagttgtgaacattgtggcatctgctccacgatcttcggctgctaaactagttgttgaggcagctgttc |
126 |
Q |
| |
|
|||||||||||||||| ||| | |||||||| | |||||||||||||| || || ||| | ||||||| | || | |||||| ||||||||| |
|
|
| T |
6833134 |
tttgggatgttttatcaaacgaagaagttgtggagattgtggcatctgcaccgcggtctactgctgctagattactggttgagtcagctgttc |
6833042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University