View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20706_high_73 (Length: 227)
Name: NF20706_high_73
Description: NF20706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20706_high_73 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 15 - 209
Target Start/End: Complemental strand, 42272347 - 42272153
Alignment:
| Q |
15 |
agagaagaataaaacaatagagaatgccggaggaacaaggttgtaatttgcttctttacctgggacggtgaccacagcatcacgaatagttttgccaagg |
114 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42272347 |
agagaagaataaaacaatagagaatgccgaaggaacaaggttgtaatttgcttctttacctgggacggtgaccacagcatcacgaatagttttgccaagg |
42272248 |
T |
 |
| Q |
115 |
aatccttcggcggtttccttcatcttaccgagaatcatggcgctgatttcctcagggctgaacaccttggtctcaccatccttcactctaacctg |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
42272247 |
aatccttcggcggtttccttcatcttaccgagaatcatggcgctgatttcctcagggctgaacaccttggtctcaccatcctttactctaacctg |
42272153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 72 - 209
Target Start/End: Complemental strand, 42324430 - 42324293
Alignment:
| Q |
72 |
acctgggacggtgaccacagcatcacgaatagttttgccaaggaatccttcggcggtttccttcatcttaccgagaatcatggcgctgatttcctcaggg |
171 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||||||||| |||| |||||||||||||||||| ||||||||||| |||| |||||||||| |
|
|
| T |
42324430 |
acctgggacagtgaccacggcatcacgaatagtcttgccaaggaatgcttcagcggtttccttcatcttagtcagaatcatggcactgacttcctcaggg |
42324331 |
T |
 |
| Q |
172 |
ctgaacaccttggtctcaccatccttcactctaacctg |
209 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
42324330 |
ctgaacaccttggtctcaccatcctttactctgacctg |
42324293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University