View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20706_high_76 (Length: 205)
Name: NF20706_high_76
Description: NF20706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20706_high_76 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 181; Significance: 5e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 181; E-Value: 5e-98
Query Start/End: Original strand, 9 - 205
Target Start/End: Complemental strand, 25277381 - 25277185
Alignment:
| Q |
9 |
agcagagatatgcaaagactactaccattcaccggagccggtgccggatcagcgccgaattggctcaacaacgctgtaaacctacggcagcagaatttcc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25277381 |
agcagagatatgcaaagactactaccattcaccggagccggtgccggatcagcgccaaattggctcaacaacgctgtaaacctacggcagcagaatttcc |
25277282 |
T |
 |
| Q |
109 |
tccacttacagccagatacatcacaaaacgaggatgtaagaggtataacccgggatcgaaaccgggccgaaaacaacacagaatcatcagaggagtt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25277281 |
tccacttacagccagatacatcacaaaacgaggacgtaagaggtatcacccgggatcgaaaccgggccgaaagcaacacagaatcatcagaggagtt |
25277185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University