View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20706_high_77 (Length: 205)
Name: NF20706_high_77
Description: NF20706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20706_high_77 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 14 - 187
Target Start/End: Original strand, 51872177 - 51872350
Alignment:
| Q |
14 |
gcacagaaagcttgtggggcctacattggatggtggagaaaacttgcttcctctgttgtagccaaaggaatgttttggcctttgtgtgtttcagatggtc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51872177 |
gcacagaaagcttgtggggcctacattggatggtggagaaaacttgcttcctctgttgtagccaaaggaatgttttggcctttgtgtgtttcagatggtc |
51872276 |
T |
 |
| Q |
114 |
cgtctatttatagactgtagttgctttagcaatttggaatgaaacatgcatggatttgcttgccttcccttcct |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51872277 |
cgtctatttatagactgtagttgctttagcaatttggaatgaaacatgcatggatttgcttgccttcccttcct |
51872350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 55; Significance: 8e-23; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 14 - 96
Target Start/End: Original strand, 33418684 - 33418766
Alignment:
| Q |
14 |
gcacagaaagcttgtggggcctacattggatggtggagaaaacttgcttcctctgttgtagccaaaggaatgttttggccttt |
96 |
Q |
| |
|
||||||||||| |||| |||||||||| |||| | || ||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
33418684 |
gcacagaaagcgtgtgaggcctacatttgatgctagaaaaaacttgcttcctctgttgtagccaagggaatgttttggccttt |
33418766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University