View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20706_low_34 (Length: 346)
Name: NF20706_low_34
Description: NF20706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20706_low_34 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 6 - 327
Target Start/End: Complemental strand, 25277210 - 25276883
Alignment:
| Q |
6 |
agcagcacagaatcatcagaggagttatcacaatataaagcagacatattaggacaccctctttacgatcagcttctatctgctcatgtttcgtgtctgc |
105 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25277210 |
agcaacacagaatcatcagaggagttatcacaatataaagcagacatattaggacaccctctttacgatcagcttctatctgctcatgtttcgtgtctgc |
25277111 |
T |
 |
| Q |
106 |
gaattgctacgcccgtcgatcagcttccgcggatcgacgcacagcttcagcaatcgcagcgcgtggtggataagtactcttcacttgct------aatgg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
25277110 |
gaattgctacgcccgtcgatcagcttccgcggatcgacgcacagcttcagcagtcgcagcgcgtggtggataagtactcttcacttgctaatgctaatgg |
25277011 |
T |
 |
| Q |
200 |
tgttgtggatgaaaaagagcttgatcaattcatggttagttacaacaacccaaacctaattttattatttaatatcaatcatatattaattatgtatctt |
299 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25277010 |
tgttgtggatgaaaaggagcttgatcaattcatggttagttacaacaacccaaacctaattttattatttaatatcaatcatatattaattatgtatctt |
25276911 |
T |
 |
| Q |
300 |
cttatccatgcaaatttattctattctt |
327 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
25276910 |
cttatccatgcaaatttattctattctt |
25276883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University