View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20706_low_51 (Length: 262)
Name: NF20706_low_51
Description: NF20706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20706_low_51 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 13 - 247
Target Start/End: Original strand, 43900738 - 43900971
Alignment:
| Q |
13 |
taacattaattattgtcttttatagtaaaagagttaaaccaaaagctcaaagatatagctaacaagttttgatgataaaaagaactatgtagactttcat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43900738 |
taacattaattattgtcttttatagtaaaagagttaaaccaaaagctcaaagatatagctaacaagttttgatgataaaaagaactatgtagactttcat |
43900837 |
T |
 |
| Q |
113 |
taagnnnnnnnntgtagagatgattagaaataaaatagtagtactttactgtttctctttggttctaaatctagtccttgttaccttcctattatctaat |
212 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
43900838 |
taagaaaaaaa-tgtagagatgattagaaataaaatagtagtactttactgtttctctttggttctaaatctagtccttattaccttcctattatctaat |
43900936 |
T |
 |
| Q |
213 |
gctgcagaatcatcagagaacattgcaatttattg |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
43900937 |
gctgcagaatcatcagagaacattgcaatttattg |
43900971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University