View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20706_low_59 (Length: 251)
Name: NF20706_low_59
Description: NF20706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20706_low_59 |
 |  |
|
| [»] chr2 (3 HSPs) |
 |  |
|
| [»] chr3 (9 HSPs) |
 |  |
|
| [»] chr7 (3 HSPs) |
 |  |
|
| [»] scaffold0908 (1 HSPs) |
 |  |  |
|
| [»] chr5 (9 HSPs) |
 |  |
|
| [»] scaffold1359 (1 HSPs) |
 |  |  |
|
| [»] scaffold0352 (1 HSPs) |
 |  |  |
|
| [»] scaffold0349 (1 HSPs) |
 |  |  |
|
| [»] scaffold0116 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 135; Significance: 2e-70; HSPs: 9)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 58 - 248
Target Start/End: Original strand, 19555733 - 19555923
Alignment:
| Q |
58 |
tttatatttgttgtaagcaaataatagtctcttgcttgttaagcttgagcaccataaatctcttggtgaaaccttgagcacctgaagtctttggcagttg |
157 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||| ||||||||| |
|
|
| T |
19555733 |
tttataattgttgtaagcaaataatagtctcttgcttgttaagcttgagcaccataaatctcttggtgaaactttgagcaccggaagtctctggcagttg |
19555832 |
T |
 |
| Q |
158 |
tggttgagcatagaagtctcttacaagagccctttgagcattggaaatctcttgcatgtgtgcttgagcaataaaagtctcttggagttgt |
248 |
Q |
| |
|
|| ||||| |||||||||||||| | ||||||||||||||||||||| |||||| || ||||||||| |||| ||||||||||||||||| |
|
|
| T |
19555833 |
tgattgagtatagaagtctcttaggacagccctttgagcattggaaatatcttgcctgcgtgcttgaggaatagaagtctcttggagttgt |
19555923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 85 - 251
Target Start/End: Original strand, 22223177 - 22223344
Alignment:
| Q |
85 |
tctcttgcttgttaagcttgagcaccataaatctcttggtgaaaccttgagcacctgaagtctttggcagttgtggttgagca-tagaagtctcttacaa |
183 |
Q |
| |
|
|||||||||||| ||||||||||| ||||| | |||||||||||| ||||||||| |||||||| | |||||||| ||||||| ||||||||||||| |
|
|
| T |
22223177 |
tctcttgcttgtgaagcttgagcatcataagtttcttggtgaaactttgagcaccagaagtcttagtcagttgtgattgagcactagaagtctcttaggg |
22223276 |
T |
 |
| Q |
184 |
gagccctttgagcattggaaatctcttgcatgtgtgcttgagcaataaaagtctcttggagttgtcct |
251 |
Q |
| |
|
|||||| ||||||| ||| ||| || | || | ||||||||||| |||||||||||||||||||| |
|
|
| T |
22223277 |
ttgcccttagagcattagaagtctttttcctgcgctcttgagcaatagaagtctcttggagttgtcct |
22223344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 62 - 139
Target Start/End: Original strand, 21588704 - 21588781
Alignment:
| Q |
62 |
tatttgttgtaagcaaataatagtctcttgcttgttaagcttgagcaccataaatctcttggtgaaaccttgagcacc |
139 |
Q |
| |
|
|||||||||||| |||| | |||||||||||||| ||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
21588704 |
tatttgttgtaaacaaacataagtctcttgcttgtgaagcttgagcaatataaatctcttgttgaaaccttgagcacc |
21588781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 18 - 58
Target Start/End: Original strand, 19554465 - 19554505
Alignment:
| Q |
18 |
gcttcaatgtctgccacggttctttggagtgattctaaatt |
58 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
19554465 |
gcttcaatgtctgccacggttctttggagggattctaaatt |
19554505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 191 - 241
Target Start/End: Complemental strand, 16939584 - 16939534
Alignment:
| Q |
191 |
ttgagcattggaaatctcttgcatgtgtgcttgagcaataaaagtctcttg |
241 |
Q |
| |
|
||||||| | ||| |||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
16939584 |
ttgagcaatagaagtctcttgcatttgtgcttgagcaatagaagtctcttg |
16939534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 241
Target Start/End: Original strand, 3105959 - 3105995
Alignment:
| Q |
205 |
tctcttgcatgtgtgcttgagcaataaaagtctcttg |
241 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
3105959 |
tctcttgcatttgtgcttgagcaatagaagtctcttg |
3105995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 241
Target Start/End: Complemental strand, 16853075 - 16853039
Alignment:
| Q |
205 |
tctcttgcatgtgtgcttgagcaataaaagtctcttg |
241 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
16853075 |
tctcttgcatttgtgcttgagcaatagaagtctcttg |
16853039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 241
Target Start/End: Complemental strand, 16939600 - 16939564
Alignment:
| Q |
205 |
tctcttgcatgtgtgcttgagcaataaaagtctcttg |
241 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
16939600 |
tctcttgcatttgtgcttgagcaatagaagtctcttg |
16939564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 241
Target Start/End: Complemental strand, 55731417 - 55731381
Alignment:
| Q |
205 |
tctcttgcatgtgtgcttgagcaataaaagtctcttg |
241 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
55731417 |
tctcttgcatttgtgcttgagcaatagaagtctcttg |
55731381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 71; Significance: 3e-32; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 58 - 251
Target Start/End: Complemental strand, 19564332 - 19564138
Alignment:
| Q |
58 |
tttatatttgttgtaagcaaataatagtctcttgcttgttaagcttgagcaccataaatctcttggtgaaaccttgagcacctgaagtctttggcagttg |
157 |
Q |
| |
|
|||||||||||||||| |||| | |||||||||||||| ||||||||||| ||||| ||||||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
19564332 |
tttatatttgttgtaaacaaacagaagtctcttgcttgtgaagcttgagcaacataagtctcttggtgaaatcttgagcactagaagtctcaatcagttg |
19564233 |
T |
 |
| Q |
158 |
tggttgagca-tagaagtctcttacaagagccctttgagcattggaaatctcttgcatgtgtgcttgagcaataaaagtctcttggagttgtcct |
251 |
Q |
| |
|
|| ||||||| ||||||||||||| | ||||||||||||||| |||||| |||| ||||| ||||||| |||||||||| ||||||||| |
|
|
| T |
19564232 |
tgattgagcactagaagtctcttagggttactctttgagcattggaagtctctttcatgcatgcttaagcaatagaagtctcttgtagttgtcct |
19564138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 58 - 147
Target Start/End: Original strand, 22312190 - 22312279
Alignment:
| Q |
58 |
tttatatttgttgtaagcaaataatagtctcttgcttgttaagcttgagcaccataaatctcttggtgaaaccttgagcacctgaagtct |
147 |
Q |
| |
|
|||||||| ||||||| |||||| |||||||| ||||| ||||||||||| || || |||||||| |||| ||||||||| ||||||| |
|
|
| T |
22312190 |
tttatattcgttgtaaacaaatacaagtctctttcttgtgaagcttgagcatcagaagtctcttggcgaaaacttgagcactcgaagtct |
22312279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 191 - 227
Target Start/End: Complemental strand, 22763366 - 22763330
Alignment:
| Q |
191 |
ttgagcattggaaatctcttgcatgtgtgcttgagca |
227 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
22763366 |
ttgagcattggaagtctcttgcctgtgtgcttgagca |
22763330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 45; Significance: 1e-16; HSPs: 8)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 56 - 180
Target Start/End: Original strand, 37283745 - 37283868
Alignment:
| Q |
56 |
attttatatttgttgtaagcaaataatagtctcttgcttgttaagcttgagcaccataaatctcttggtgaaaccttgagcacctgaagtctttggcagt |
155 |
Q |
| |
|
|||||||||||| ||||| |||| | ||| |||||||||| ||||||||||| ||||| |||||||||||||| ||||||| | |||||| |||| |
|
|
| T |
37283745 |
attttatatttgctgtaaacaaacataagtatcttgcttgtgaagcttgagcatcataagtctcttggtgaaactttgagcatc-aaagtctcaatcagt |
37283843 |
T |
 |
| Q |
156 |
tgtggttgagcatagaagtctctta |
180 |
Q |
| |
|
|| | |||||||||||||||||||| |
|
|
| T |
37283844 |
tgcgattgagcatagaagtctctta |
37283868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 191 - 251
Target Start/End: Original strand, 12669581 - 12669641
Alignment:
| Q |
191 |
ttgagcattggaaatctcttgcatgtgtgcttgagcaataaaagtctcttggagttgtcct |
251 |
Q |
| |
|
|||||||||| || || ||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
12669581 |
ttgagcattgaaagtcgcttgcctgtgtgcttgagcaatagaagtctcttggagttgtcct |
12669641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 201 - 241
Target Start/End: Original strand, 25449057 - 25449097
Alignment:
| Q |
201 |
gaaatctcttgcatgtgtgcttgagcaataaaagtctcttg |
241 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
25449057 |
gaaatctcttgcatttgtgcttgagcaatagaagtctcttg |
25449097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 223 - 251
Target Start/End: Original strand, 12669643 - 12669671
Alignment:
| Q |
223 |
gagcaataaaagtctcttggagttgtcct |
251 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
12669643 |
gagcaataaaagtctcttggagttgtcct |
12669671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 191 - 227
Target Start/End: Original strand, 18382444 - 18382480
Alignment:
| Q |
191 |
ttgagcattggaaatctcttgcatgtgtgcttgagca |
227 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |
|
|
| T |
18382444 |
ttgagcattggaagactcttgcatgtgtgcttgagca |
18382480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 241
Target Start/End: Original strand, 21135665 - 21135701
Alignment:
| Q |
205 |
tctcttgcatgtgtgcttgagcaataaaagtctcttg |
241 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
21135665 |
tctcttgcagttgtgcttgagcaataaaagtctcttg |
21135701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 191 - 227
Target Start/End: Original strand, 46181391 - 46181427
Alignment:
| Q |
191 |
ttgagcattggaaatctcttgcatgtgtgcttgagca |
227 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
46181391 |
ttgagcattggaagtctcttgcatgcgtgcttgagca |
46181427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 241
Target Start/End: Original strand, 48570734 - 48570770
Alignment:
| Q |
205 |
tctcttgcatgtgtgcttgagcaataaaagtctcttg |
241 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
48570734 |
tctcttgcagttgtgcttgagcaataaaagtctcttg |
48570770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 9)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 8710454 - 8710394
Alignment:
| Q |
191 |
ttgagcattggaaatctcttgcatgtgtgcttgagcaataaaagtctcttggagttgtcct |
251 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||||| |||||||||| |||| |||| |
|
|
| T |
8710454 |
ttgagcattggaagtctcttgcctgtgtgcttgagcaatagaagtctcttgaagttatcct |
8710394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 9062341 - 9062281
Alignment:
| Q |
191 |
ttgagcattggaaatctcttgcatgtgtgcttgagcaataaaagtctcttggagttgtcct |
251 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||||| |||||||||| |||| |||| |
|
|
| T |
9062341 |
ttgagcattggaagtctcttgcctgtgtgcttgagcaatagaagtctcttgaagttatcct |
9062281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 11074129 - 11074069
Alignment:
| Q |
191 |
ttgagcattggaaatctcttgcatgtgtgcttgagcaataaaagtctcttggagttgtcct |
251 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
11074129 |
ttgagcattggatgtctcttgcctgtgtgcttgagcaatataagtctcttggagttatcct |
11074069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 186 - 246
Target Start/End: Complemental strand, 10917900 - 10917840
Alignment:
| Q |
186 |
gccctttgagcattggaaatctcttgcatgtgtgcttgagcaataaaagtctcttggagtt |
246 |
Q |
| |
|
|||||||||| ||||||| | |||||| ||||||||||||||||| ||||||| ||||||| |
|
|
| T |
10917900 |
gccctttgagaattggaagtttcttgcttgtgtgcttgagcaatagaagtctcctggagtt |
10917840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 191 - 251
Target Start/End: Complemental strand, 11074069 - 11074009
Alignment:
| Q |
191 |
ttgagcattggaaatctcttgcatgtgtgcttgagcaataaaagtctcttggagttgtcct |
251 |
Q |
| |
|
|||| ||||| || |||||||| || |||||||||||||| |||||||||||||||||||| |
|
|
| T |
11074069 |
ttgatcattgtaagtctcttgcctgcgtgcttgagcaatagaagtctcttggagttgtcct |
11074009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 187 - 251
Target Start/End: Complemental strand, 10923129 - 10923065
Alignment:
| Q |
187 |
ccctttgagcattggaaatctcttgcatgtgtgcttgagcaataaaagtctcttggagttgtcct |
251 |
Q |
| |
|
||||||||| |||||| |||||| | || ||||||| ||||| |||||||||||||||||||| |
|
|
| T |
10923129 |
ccctttgagagttggaagtctcttacttgcatgcttgaacaatagaagtctcttggagttgtcct |
10923065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 241
Target Start/End: Original strand, 21606238 - 21606274
Alignment:
| Q |
205 |
tctcttgcatgtgtgcttgagcaataaaagtctcttg |
241 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
21606238 |
tctcttgcatttgtgcttgagcaatagaagtctcttg |
21606274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 241
Target Start/End: Original strand, 49669073 - 49669109
Alignment:
| Q |
205 |
tctcttgcatgtgtgcttgagcaataaaagtctcttg |
241 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
49669073 |
tctcttgcagttgtgcttgagcaataaaagtctcttg |
49669109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 241
Target Start/End: Complemental strand, 50299809 - 50299773
Alignment:
| Q |
205 |
tctcttgcatgtgtgcttgagcaataaaagtctcttg |
241 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
50299809 |
tctcttgcatttgtgcttgagcaatataagtctcttg |
50299773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 58 - 251
Target Start/End: Complemental strand, 22974964 - 22974771
Alignment:
| Q |
58 |
tttatatttgttgtaagcaaataatagtctcttgcttgttaagcttgagcaccataaatctcttggtgaaaccttgagcacctgaagtctttggcagttg |
157 |
Q |
| |
|
||||||||| ||||| ||| || |||||||| ||||| ||||||||||| ||||| |||||||| ||| |||||||| || |||||| | | ||| |
|
|
| T |
22974964 |
tttatattttctgtaaacaagtagaagtctctttcttgtgaagcttgagcatcataagtctcttggagaatccttgagcgccataagtctctttaaattg |
22974865 |
T |
 |
| Q |
158 |
tggttgagca-tagaagtctcttacaagagccctttgagcattggaaatctcttgcatgtgtgcttgagcaataaaagtctcttggagttgtcct |
251 |
Q |
| |
|
| || | || |||||||||||| | ||||||| ||||||||| | |||||||| |||||| | ||||||||||| |||||||||||| |||| |
|
|
| T |
22974864 |
taattaaacaatagaagtctcttggcatagccctt-gagcattggtagtctcttgcctgtgtgttggagcaataaaaatctcttggagttttcct |
22974771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 241
Target Start/End: Original strand, 12174925 - 12174961
Alignment:
| Q |
205 |
tctcttgcatgtgtgcttgagcaataaaagtctcttg |
241 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
12174925 |
tctcttgcatttgtgcttgagcaatagaagtctcttg |
12174961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 241
Target Start/End: Complemental strand, 14426120 - 14426084
Alignment:
| Q |
205 |
tctcttgcatgtgtgcttgagcaataaaagtctcttg |
241 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
14426120 |
tctcttgcagttgtgcttgagcaataaaagtctcttg |
14426084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 5)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 205 - 248
Target Start/End: Original strand, 14990644 - 14990687
Alignment:
| Q |
205 |
tctcttgcatgtgtgcttgagcaataaaagtctcttggagttgt |
248 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||||| |||||| |
|
|
| T |
14990644 |
tctcttgcatttgtgcttgagcaatagaagtctcttgcagttgt |
14990687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 205 - 248
Target Start/End: Original strand, 18152229 - 18152272
Alignment:
| Q |
205 |
tctcttgcatgtgtgcttgagcaataaaagtctcttggagttgt |
248 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||||| |||||| |
|
|
| T |
18152229 |
tctcttgcatttgtgcttgagcaatagaagtctcttgcagttgt |
18152272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 191 - 241
Target Start/End: Complemental strand, 21540510 - 21540460
Alignment:
| Q |
191 |
ttgagcattggaaatctcttgcatgtgtgcttgagcaataaaagtctcttg |
241 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
21540510 |
ttgagcataggaagtctcttgcatgtgtgcttgagcaaaggaagtctcttg |
21540460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 191 - 225
Target Start/End: Complemental strand, 28888822 - 28888788
Alignment:
| Q |
191 |
ttgagcattggaaatctcttgcatgtgtgcttgag |
225 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |
|
|
| T |
28888822 |
ttgagcattggaagtctcttgcatgtgtgcttgag |
28888788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 241
Target Start/End: Original strand, 33560797 - 33560833
Alignment:
| Q |
205 |
tctcttgcatgtgtgcttgagcaataaaagtctcttg |
241 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
33560797 |
tctcttgcatttgtgcttgagcaatagaagtctcttg |
33560833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0908 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0908
Description:
Target: scaffold0908; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 191 - 241
Target Start/End: Original strand, 4445 - 4495
Alignment:
| Q |
191 |
ttgagcattggaaatctcttgcatgtgtgcttgagcaataaaagtctcttg |
241 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
4445 |
ttgagcataggaaatctcttgcttgtgtgcttgagcaaaggaagtctcttg |
4495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 191 - 249
Target Start/End: Complemental strand, 10820746 - 10820688
Alignment:
| Q |
191 |
ttgagcattggaaatctcttgcatgtgtgcttgagcaataaaagtctcttggagttgtc |
249 |
Q |
| |
|
|||||||||| |||| | |||| || ||||||||||| || |||||||||||||||||| |
|
|
| T |
10820746 |
ttgagcattgaaaatatattgcctgcgtgcttgagcattagaagtctcttggagttgtc |
10820688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 191 - 227
Target Start/End: Original strand, 7751742 - 7751778
Alignment:
| Q |
191 |
ttgagcattggaaatctcttgcatgtgtgcttgagca |
227 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
7751742 |
ttgagcattggaagtctcttgcgtgtgtgcttgagca |
7751778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 191 - 227
Target Start/End: Complemental strand, 27384123 - 27384087
Alignment:
| Q |
191 |
ttgagcattggaaatctcttgcatgtgtgcttgagca |
227 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
27384123 |
ttgagcattggaagtctcttgcgtgtgtgcttgagca |
27384087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 191 - 227
Target Start/End: Complemental strand, 27474507 - 27474471
Alignment:
| Q |
191 |
ttgagcattggaaatctcttgcatgtgtgcttgagca |
227 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
27474507 |
ttgagcattggaagtctcttgcgtgtgtgcttgagca |
27474471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 191 - 227
Target Start/End: Complemental strand, 27504005 - 27503969
Alignment:
| Q |
191 |
ttgagcattggaaatctcttgcatgtgtgcttgagca |
227 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
27504005 |
ttgagcattggaagtctcttgcgtgtgtgcttgagca |
27503969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 9)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 190 - 251
Target Start/End: Original strand, 24494982 - 24495043
Alignment:
| Q |
190 |
tttgagcattggaaatctcttgcatgtgtgcttgagcaataaaagtctcttggagttgtcct |
251 |
Q |
| |
|
||||||||| ||| |||||| || |||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
24494982 |
tttgagcatcagaagtctctttcaattgtgattgagcaataaaagtctcttgaagttgtcct |
24495043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 193 - 241
Target Start/End: Complemental strand, 4886548 - 4886500
Alignment:
| Q |
193 |
gagcattggaaatctcttgcatgtgtgcttgagcaataaaagtctcttg |
241 |
Q |
| |
|
|||||| |||| ||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
4886548 |
gagcataggaagtctcttgcagttgtgcttgagcaatagaagtctcttg |
4886500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 241
Target Start/End: Complemental strand, 10848345 - 10848309
Alignment:
| Q |
205 |
tctcttgcatgtgtgcttgagcaataaaagtctcttg |
241 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
10848345 |
tctcttgcagttgtgcttgagcaataaaagtctcttg |
10848309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 241
Target Start/End: Complemental strand, 11993463 - 11993427
Alignment:
| Q |
205 |
tctcttgcatgtgtgcttgagcaataaaagtctcttg |
241 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
11993463 |
tctcttgcagttgtgcttgagcaataaaagtctcttg |
11993427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 241
Target Start/End: Original strand, 29138969 - 29139005
Alignment:
| Q |
205 |
tctcttgcatgtgtgcttgagcaataaaagtctcttg |
241 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
29138969 |
tctcttgcagttgtgcttgagcaataaaagtctcttg |
29139005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 241
Target Start/End: Complemental strand, 30742555 - 30742519
Alignment:
| Q |
205 |
tctcttgcatgtgtgcttgagcaataaaagtctcttg |
241 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
30742555 |
tctcttgcatttgtgcttgagcaatagaagtctcttg |
30742519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 241
Target Start/End: Complemental strand, 33932841 - 33932805
Alignment:
| Q |
205 |
tctcttgcatgtgtgcttgagcaataaaagtctcttg |
241 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
33932841 |
tctcttgcatttgtgcttgagcaatagaagtctcttg |
33932805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 191 - 227
Target Start/End: Original strand, 36229355 - 36229391
Alignment:
| Q |
191 |
ttgagcattggaaatctcttgcatgtgtgcttgagca |
227 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |
|
|
| T |
36229355 |
ttgagcattggaagactcttgcatgtgtgcttgagca |
36229391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 241
Target Start/End: Complemental strand, 42243254 - 42243218
Alignment:
| Q |
205 |
tctcttgcatgtgtgcttgagcaataaaagtctcttg |
241 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
42243254 |
tctcttgcatttgtgcttgagcaatagaagtctcttg |
42243218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1359 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold1359
Description:
Target: scaffold1359; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 241
Target Start/End: Original strand, 1189 - 1225
Alignment:
| Q |
205 |
tctcttgcatgtgtgcttgagcaataaaagtctcttg |
241 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1189 |
tctcttgcagttgtgcttgagcaataaaagtctcttg |
1225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0352 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0352
Description:
Target: scaffold0352; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 241
Target Start/End: Original strand, 1355 - 1391
Alignment:
| Q |
205 |
tctcttgcatgtgtgcttgagcaataaaagtctcttg |
241 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1355 |
tctcttgcagttgtgcttgagcaataaaagtctcttg |
1391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0349 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0349
Description:
Target: scaffold0349; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 191 - 227
Target Start/End: Complemental strand, 14064 - 14028
Alignment:
| Q |
191 |
ttgagcattggaaatctcttgcatgtgtgcttgagca |
227 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
14064 |
ttgagcattggaagtctcttgcctgtgtgcttgagca |
14028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0116 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0116
Description:
Target: scaffold0116; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 241
Target Start/End: Original strand, 2508 - 2544
Alignment:
| Q |
205 |
tctcttgcatgtgtgcttgagcaataaaagtctcttg |
241 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
2508 |
tctcttgcatttgtgcttgagcaatagaagtctcttg |
2544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University