View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20706_low_61 (Length: 250)
Name: NF20706_low_61
Description: NF20706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20706_low_61 |
 |  |
|
| [»] chr4 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 159; Significance: 9e-85; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 80 - 250
Target Start/End: Original strand, 39582189 - 39582359
Alignment:
| Q |
80 |
aacaactactggaaccattagagacctgaaaaatgaaaaatctctgttaaaacgtgattggttggttcggattatagatgcacttaatataataatttat |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39582189 |
aacaactactggaaccattagagacctgaaaaatgaaaaatccctgttaaaacgtgattggttggtttggattatagatgcacttaatataataatttat |
39582288 |
T |
 |
| Q |
180 |
tttctatggagactagctagagacatccttcctactagatagatgtagaccgaagcgaaaaggattgagta |
250 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39582289 |
tttctatggagactagctagagatatccttcctactagatagatgtagaccgaagcgaaaaggattgagta |
39582359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 125 - 181
Target Start/End: Original strand, 39581544 - 39581600
Alignment:
| Q |
125 |
gttaaaacgtgattggttggttcggattatagatgcacttaatataataatttattt |
181 |
Q |
| |
|
|||||||| ||||||||||||| ||||| | || ||||||| ||||||||||||||| |
|
|
| T |
39581544 |
gttaaaacatgattggttggtttggattttcgacgcacttattataataatttattt |
39581600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 100 - 181
Target Start/End: Original strand, 39576961 - 39577042
Alignment:
| Q |
100 |
gagacctgaaaaatgaaaaatctctgttaaaacgtgattggttggttcggattatagatgcacttaatataataatttattt |
181 |
Q |
| |
|
||||| ||||||| |||| ||| ||||| |||||||||||| ||| ||||| ||||| || ||| ||||||||||||||| |
|
|
| T |
39576961 |
gagacatgaaaaaggaaagctctacgttaagacgtgattggttagttaggattttagatacatttattataataatttattt |
39577042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University