View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20706_low_68 (Length: 238)
Name: NF20706_low_68
Description: NF20706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20706_low_68 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 18 - 143
Target Start/End: Original strand, 23585157 - 23585282
Alignment:
| Q |
18 |
caataatctatatatagtttggtactgcaacttggctttattagtcctcatgnnnnnnnnttcttttcaatcaaatgcggtttaattaatttaaatttct |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23585157 |
caataatctatatatagtttggtactgcaacttggctttatcagtcctcatgaaaaaaaattcttttcaatcaaatgcggtttaattaatttaaatttct |
23585256 |
T |
 |
| Q |
118 |
ttttggatttccaaattatgattgtg |
143 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
23585257 |
ttttggatttccaaattatgattgtg |
23585282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University