View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20706_low_70 (Length: 237)
Name: NF20706_low_70
Description: NF20706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20706_low_70 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 48260413 - 48260635
Alignment:
| Q |
1 |
gttgatagtaagtttaagagatttttctcctttaggcccaagtcaaatttgggtcgaacatggtgaacacatatcattgtattttttcttcttctccttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| ||||||||||||| |||||||||||||||| |||||||||| ||||| |||| |||||||| |
|
|
| T |
48260413 |
gttgatagtaagtttaagagatttttctccttttggcctaagtcaaatttggatcgaacatggtgaacaaatatcattgtgtttttccttcctctccttt |
48260512 |
T |
 |
| Q |
101 |
atcatannnnnnnngtttgtgcttgtttaatcactttaattttgattgttgctaattctacg--ctatatatatcaaaatattgatgtaagttttatttg |
198 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || |
|
|
| T |
48260513 |
atcatattttttttgtttgtgcttgtttaatcactttaattttgattgttgctaattctacgttatatatatatcaaaatattgatgtaagttttatctg |
48260612 |
T |
 |
| Q |
199 |
aattcacaacggtatcaacttta |
221 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
48260613 |
aattcacaacggtatcaacttta |
48260635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 115 - 157
Target Start/End: Complemental strand, 2329207 - 2329165
Alignment:
| Q |
115 |
gtttgtgcttgtttaatcactttaattttgattgttgctaatt |
157 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
2329207 |
gtttgtgcttgtttaatcactttggttttggttgttgctaatt |
2329165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University