View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20706_low_76 (Length: 222)
Name: NF20706_low_76
Description: NF20706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20706_low_76 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 17 - 201
Target Start/End: Original strand, 5898069 - 5898253
Alignment:
| Q |
17 |
atatagattatagttggattatatatttgtttatacatttttatatactaattatgtaactaagttgagatcaaatagttgatgaatttcaattaaagat |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
5898069 |
atatagattatagttggattatatatttgtttatacatttttatatatcaattatgtaactaagttgagatcaaatagttgatgagttttaattaaagat |
5898168 |
T |
|
| Q |
117 |
gaatcgtttnnnnnnnttgaaacttgaatcctgactataatagttattgatcaaattttatttacatttaattgaactatttact |
201 |
Q |
| |
|
||||||||| | ||| || ||| |||||||||||| |||||||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
5898169 |
gaatcgtttaaaaaaactaaaatttaaattctgactataataattattgatcaaactttatttacatttaattgatctatttact |
5898253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University