View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20707_low_2 (Length: 288)
Name: NF20707_low_2
Description: NF20707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20707_low_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 15 - 277
Target Start/End: Complemental strand, 5046628 - 5046366
Alignment:
| Q |
15 |
acaaggaagatcataaagctgcaaaaggctatacaaaatatcttgctttgcacttaagatttgaaatagatatggtggcctattccatgtgtgagtttgg |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
5046628 |
acaaggaagatcataaagctgcaaaaggctatacaaaatatcttgctttgcacttaagatttgaaatagatatggtggcttattccatgtgtgagtttgg |
5046529 |
T |
 |
| Q |
115 |
aggaggtgaaagtgagagaaaggaacttcaagcctatagagaaaggcatttccctctctttctggagcgcttgaagaattcaacgtatgcatgtttctac |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5046528 |
aggaggtgaaagtgagagaaaggaacttcaagcctacagagaaaggcatttccctctctttctggagcgcttgaagaattcaacgtatgcatgtttctac |
5046429 |
T |
 |
| Q |
215 |
tatttgcttttcagcacaatgttttcgactgataagtatccttgttaattatttgttgatatt |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5046428 |
tatttgcttttcagcacaatgttttcgactgataagtatccttgttaattatttgttgatatt |
5046366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University