View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20709_high_17 (Length: 320)
Name: NF20709_high_17
Description: NF20709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20709_high_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 5e-93; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 118 - 317
Target Start/End: Complemental strand, 51118533 - 51118333
Alignment:
| Q |
118 |
tttgcacctcaacagatgatacaa-tcccaaacaactaaatatcgctcaaataaatagttataaacttgaaaatatttgtcgagtactcaatccttatct |
216 |
Q |
| |
|
||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51118533 |
tttgcacttcaacagatgatacaaatcccaaacaactaaatatcgctcaaataaatagttataaacttgaaaatatttgtcgagtactcaatccttatct |
51118434 |
T |
 |
| Q |
217 |
gtttgcagccgctgatcggtatggcttcaatagctacctgaagtgcaaagcaagacattcaagatgttgcaaacattaatatgaccatgactatatctct |
316 |
Q |
| |
|
||| |||||| |||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51118433 |
gttagcagccactgatccgtatggcttcaatagctacctgaagtgcaaagcaaggcattcaagatgttgcaaacattaatatgaccatgactatatctct |
51118334 |
T |
 |
| Q |
317 |
g |
317 |
Q |
| |
|
| |
|
|
| T |
51118333 |
g |
51118333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 51118613 - 51118558
Alignment:
| Q |
1 |
ttgactatgcttttgtaaatagatacaaaatttgaaatcttatcaactatgaagct |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
51118613 |
ttgactatgcttttgtaaatagatacaaaatttgaaatcttaccaactatgaagct |
51118558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University