View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20709_low_10 (Length: 424)
Name: NF20709_low_10
Description: NF20709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20709_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 153; Significance: 6e-81; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 153; E-Value: 6e-81
Query Start/End: Original strand, 14 - 323
Target Start/End: Complemental strand, 10594571 - 10594284
Alignment:
| Q |
14 |
ctgtctagatttttcgtaacaggtaatatatggcccacatattcagccacgtgttaaaggcatacatctcagaatgttctttgtattttttggtcagttg |
113 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
10594571 |
ctgtctagatgtttcgtaacaggtaatatatggcccacatattcagccacgtgttaaaggcatacatctcagaatgttctttgtgtt------------- |
10594485 |
T |
 |
| Q |
114 |
tgttctttctttctttagaaaaataaataaattggaacactttgaaatttattttttgtagcccatgtatttttctnnnnnnnnnnnnnnnnnnncgtat |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10594484 |
--------ctttctttagaaaaataaataaattggaacactttgaaatttattttttgtagcccatgtatttttc-aaaaaaaaataaaaataaacgtat |
10594394 |
T |
 |
| Q |
214 |
acttttgggcttagaatagttaatattagcttcccttttattatttgaaaaattgctcttttaacccttttattactcatgtaggccctctaaaatttcc |
313 |
Q |
| |
|
| |||||||||| |||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10594393 |
agttttgggcttggaatagttaataatatcttcccttttattatttgaaaaattgctcttttaacccttttattactcatgtaggccctctaaaatttcc |
10594294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 361 - 405
Target Start/End: Complemental strand, 10594093 - 10594049
Alignment:
| Q |
361 |
tttgggatataacttcggatccgtaacatttttacgcctgaacag |
405 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
10594093 |
tttgggagataacttgggatccgtaacatttttacgcctaaacag |
10594049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 332 - 363
Target Start/End: Complemental strand, 10594151 - 10594120
Alignment:
| Q |
332 |
aaggtaaatcagagttacgaatcaataggttt |
363 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
10594151 |
aaggtaaatcagagttacgaatcaataggttt |
10594120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University