View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20709_low_27 (Length: 201)
Name: NF20709_low_27
Description: NF20709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20709_low_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 102; Significance: 7e-51; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 102; E-Value: 7e-51
Query Start/End: Original strand, 21 - 171
Target Start/End: Complemental strand, 48000540 - 48000399
Alignment:
| Q |
21 |
atattcacatgtggggctttaaggaagacaacaatgtcagcagcaacaatatactatcaaagtaaaagttgcttgataactcatatcaaattttcaaccc |
120 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
48000540 |
atattcacatgtggagctttaaggaagacaacaatgtcagcagcaac-------tatcaaagtaaaagttgcttgataactcat--caaattttcaaccc |
48000450 |
T |
 |
| Q |
121 |
acttaggaatcaaacaatatactaccaaagtgtgtcctaaatttgcaacac |
171 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
48000449 |
acttaagaatcaaacaatatactaccaaagtgtgtgctaaatttgcaacac |
48000399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 76
Target Start/End: Original strand, 48000343 - 48000391
Alignment:
| Q |
28 |
catgtggggctttaaggaagacaacaatgtcagcagcaacaatatacta |
76 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
48000343 |
catgtggggctttaaagaagacaacaatatcagcagcaacaatatacta |
48000391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University