View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2070_high_6 (Length: 258)
Name: NF2070_high_6
Description: NF2070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2070_high_6 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 29838221 - 29838461
Alignment:
| Q |
1 |
gaggtaccttctaaaattcatacatatttttgagtttaatttacttcctatagagaagaatgctgatcaatttgttccggttacttttgtgcgctcttta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29838221 |
gaggtaccttctaaaattcatacatatttttgagtttaatttacttcctatagagaagaatgctgatcaatttgttccggttacttttgtgcgctcttta |
29838320 |
T |
|
| Q |
101 |
caggaaacaaccatgtctaatgcttggtatgaggtgttgtcggttttgcatttgatgtcaatgctattactgtcaaaggctaatttgctgctgcttccaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29838321 |
caggaaacaaccatgtctaatgcttggtatgaggtgttgtcggttttgcatttgatgtcaatgctattactgtcaaaggctaatttgctgctgcttccaa |
29838420 |
T |
|
| Q |
201 |
gatcatccagtgacggtcatcagcagagagtatcagatggt |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29838421 |
gatcatccagtgacggtcatcagcagagagtatcagatggt |
29838461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 101 - 237
Target Start/End: Complemental strand, 34628284 - 34628148
Alignment:
| Q |
101 |
caggaaacaaccatgtctaatgcttggtatgaggtgttgtcggttttgcatttgatgtcaatgctattactgtcaaaggctaatttgctgctgcttccaa |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||| || ||||| |||||| ||| ||||| || ||| |||||||||| | || ||||||| |
|
|
| T |
34628284 |
caggaaacagccatgtctaatgcttggtatgaagtgttgtcagtcttgcacttgatggcaacactattgctatcacaggctaatttattacttcttccaa |
34628185 |
T |
|
| Q |
201 |
gatcatccagtgacggtcatcagcagagagtatcaga |
237 |
Q |
| |
|
|| |||||| || |||||||||| | ||||||||| |
|
|
| T |
34628184 |
gaacatccaccgatggtcatcagccaaaagtatcaga |
34628148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University