View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2070_low_8 (Length: 232)
Name: NF2070_low_8
Description: NF2070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2070_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 18 - 221
Target Start/End: Complemental strand, 34101591 - 34101388
Alignment:
| Q |
18 |
caatggcgaacgcaatactcgcccccttccaacgataagcgcgctgaggttgagagtgttgatctctaagcagagacgctccttgatttcatgatccatc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34101591 |
caatggcgaacgcaatactcgcccccttccaacgataagcgcgctgaggttgagactgttgatctctaagcagagacgctccttgatttcatgatccatc |
34101492 |
T |
|
| Q |
118 |
acaatatggagattgtgaggaatctgtgcttgaagtaacggtttcgcaaaatcgttaagtttggaaatcgtgtacacgtggaagtagtttttcatcttct |
217 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34101491 |
acaatgtggagattgtaaggaatctgtgcttgaagtaacgatttcgcaaaatcgtcaagtttggaaatcgtgtacacgtggaagtagtttttcatcttct |
34101392 |
T |
|
| Q |
218 |
tcat |
221 |
Q |
| |
|
|||| |
|
|
| T |
34101391 |
tcat |
34101388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University