View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20710_high_12 (Length: 246)
Name: NF20710_high_12
Description: NF20710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20710_high_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 11684667 - 11684903
Alignment:
| Q |
1 |
gcaattacccggcttaagaagtactccgcaacatctggaaggaagtgaagctcgtcttttcttttgaaggtctcttgtatcgctggatctttccacactt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11684667 |
gcaattacccggcttaagaagtactccgcaacatctggaaggaagtgaagctcgtcttttcttttgaaggtctcttgtatcgctggatctttccacactt |
11684766 |
T |
|
| Q |
101 |
cttcaactagtggtgcatattcacgtgtcgctgcagggaagaatgcatctaaatccccagtggctataatgtccaggagccaatcagaaaaatgctttag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11684767 |
cttcaactagtggtgcatattcacgtgtcgctgcagggaagaatgcatctaaatccccagtggctataatgtccaggagccaatcagaaaaatgctttag |
11684866 |
T |
|
| Q |
201 |
ccttgggttgagagaatagatgcactcactagtatta |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11684867 |
ccttgggttgagagaatagatgcactcactagtatta |
11684903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 85 - 197
Target Start/End: Original strand, 26410111 - 26410223
Alignment:
| Q |
85 |
ggatctttccacacttcttcaactagtggtgcatattcacgtgtcgctgcagggaagaatgcatctaaatccccagtggctataatgtccaggagccaat |
184 |
Q |
| |
|
||||||||||| | || ||||| | ||| ||||| |||||||| || ||||| ||||| || || |||||||| || || ||||| ||||| | ||| | |
|
|
| T |
26410111 |
ggatctttccatatctcgtcaaccattggagcatactcacgtgtagcagcaggaaagaaagcctccaaatcccccgtagccataatatccagcaaccagt |
26410210 |
T |
|
| Q |
185 |
cagaaaaatgctt |
197 |
Q |
| |
|
||||||||||||| |
|
|
| T |
26410211 |
cagaaaaatgctt |
26410223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University