View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20710_high_13 (Length: 237)
Name: NF20710_high_13
Description: NF20710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20710_high_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 54; Significance: 4e-22; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 33 - 105
Target Start/End: Complemental strand, 13198940 - 13198863
Alignment:
| Q |
33 |
aagaaataaaatcaagtttacaagtttatattttggtcaaaa-----tggatgtagattgttaacttagtctttaatg |
105 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
13198940 |
aagaaataaaatcaaatttacaagtttatattttggtcaaaaataagtggatgtagattgttaacttagtctttaatg |
13198863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 166 - 222
Target Start/End: Complemental strand, 13198602 - 13198546
Alignment:
| Q |
166 |
ttaaattgttatgcataagctcaacaactccattaaggtcatagtatggtcagtatt |
222 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||| || ||||| |||| |
|
|
| T |
13198602 |
ttaaattcttatgcataagctcaacaactccattaaggtcataatagggtcaatatt |
13198546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University