View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20710_high_13 (Length: 237)

Name: NF20710_high_13
Description: NF20710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20710_high_13
NF20710_high_13
[»] chr5 (2 HSPs)
chr5 (33-105)||(13198863-13198940)
chr5 (166-222)||(13198546-13198602)


Alignment Details
Target: chr5 (Bit Score: 54; Significance: 4e-22; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 33 - 105
Target Start/End: Complemental strand, 13198940 - 13198863
Alignment:
33 aagaaataaaatcaagtttacaagtttatattttggtcaaaa-----tggatgtagattgttaacttagtctttaatg 105  Q
    ||||||||||||||| ||||||||||||||||||||||||||     |||||||||||||||||||||||||||||||    
13198940 aagaaataaaatcaaatttacaagtttatattttggtcaaaaataagtggatgtagattgttaacttagtctttaatg 13198863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 166 - 222
Target Start/End: Complemental strand, 13198602 - 13198546
Alignment:
166 ttaaattgttatgcataagctcaacaactccattaaggtcatagtatggtcagtatt 222  Q
    ||||||| ||||||||||||||||||||||||||||||||||| || ||||| ||||    
13198602 ttaaattcttatgcataagctcaacaactccattaaggtcataatagggtcaatatt 13198546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University