View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20710_low_12 (Length: 270)
Name: NF20710_low_12
Description: NF20710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20710_low_12 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 20 - 270
Target Start/End: Complemental strand, 15559398 - 15559148
Alignment:
| Q |
20 |
ttgaggtgtgatgaaaccggtttttgattctgatgatataagtcataattaggttttgatgtgttttgaatgattactgtgtaatttgaattgataaatt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
15559398 |
ttgaggtgtgatgaaaccggtttttgattctgatgatataagtcataattaggttttgatgtgttttgaatgattactgtgtaatttgaattgatgaatt |
15559299 |
T |
 |
| Q |
120 |
ataattttatactgattatggtgtttgtgatcacttttgagttttgtttgatgatttcaaaattcaaaaatagggattagatttttctttttgatcgaat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15559298 |
ataattttatactgattatggtgtttgtgatcacttttgagttttgtttgatgatttcaaaattcaaaaatagggattagatttttctttttgatcgaat |
15559199 |
T |
 |
| Q |
220 |
tcaggtataacgtgttaagtggatcgtcaagaatatctgtgaaactgtgat |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15559198 |
tcaggtataacgtgttaagtggatcgtcaagaatatctgtgaaactgtgat |
15559148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University