View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20711_high_1_N (Length: 359)
Name: NF20711_high_1_N
Description: NF20711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20711_high_1_N |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 22 - 304
Target Start/End: Original strand, 34941895 - 34942177
Alignment:
| Q |
22 |
catcatcagtaattacaggagatgtgataaatcgaccacttccaacaagaggaaacaattggcgacattcttctttccatgtagcatattgtatccttat |
121 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34941895 |
catcatcagtaattacaggggatgtgataaatcgaccacttccaacaagaggaaacaattggcgacattcttttttccatgtagcatattgtatccttat |
34941994 |
T |
|
| Q |
122 |
gacataaacataaaagtgaagttcaagtaatgatctattaggtctagaattcagaaatggtggaaccgaaccatacagttcaaccggttaaaccgtgaac |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34941995 |
gacataaacataaaagtgaagttcaagtaatgatctattaggtctagaattcagaaatggtggaaccgaaccatacagttcaaccggttaaaccgtgaac |
34942094 |
T |
|
| Q |
222 |
cgatgctgtcaactattcggttatttgagtggtttgaccgctgttctgttccggtttgagcggttgaactgtgagccacaggt |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34942095 |
cgatgctgtcaactattcggttatttgagtggtttgaccgctgttctgttccggtttgagcggttgaactatgagccacaggt |
34942177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 44; Significance: 6e-16; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 45 - 112
Target Start/End: Complemental strand, 31398588 - 31398521
Alignment:
| Q |
45 |
gtgataaatcgaccacttccaacaagaggaaacaattggcgacattcttctttccatgtagcatattg |
112 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||| ||||||||||||||| |||||| ||||||||| |
|
|
| T |
31398588 |
gtgataaatctaccacttcctacaagaggaaacagttggcgacattcttccttccattcagcatattg |
31398521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University