View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20711_high_6 (Length: 343)
Name: NF20711_high_6
Description: NF20711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20711_high_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 12 - 314
Target Start/End: Complemental strand, 36058647 - 36058349
Alignment:
| Q |
12 |
atgaataggcatgaaaattacaaatgaaagagaagtgcaatggcgttgcgttctctgactgaggtgctcttgcgtcggagtgtaacgacggacggtgagt |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
36058647 |
atgaataggcatgaaaattacaaatgaaagagaagtgcaatggcgttgcgttctctgactgaggtgctcttgcgtcggagtgtaacggcgg----tgagt |
36058552 |
T |
 |
| Q |
112 |
cgacgacggtgagagagggactgttattgagtcaccgtatctgtcgccgaacaaacagaaaactcagaagttctaattgtcagattctttgaacgggatg |
211 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36058551 |
cgacgacggtgagagagggaatgttattgagtcaccgtatctgtcgccgaacaaacagaaaactcagaagttctaattgtcagattctttgaacgggatg |
36058452 |
T |
 |
| Q |
212 |
atggcacaagtgaatgtgaaatatcaattttatcccccttccaaaaccacacccattcatcccaccatgttttccggaattaaaatcgaatgatgatagt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
36058451 |
atggcacaagtgaatgtgaaatatcaattttatcccccttacaaaaccacacccattcatcccaccatgttttccggaattaaaatcgaatgatgatggt |
36058352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University