View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20711_high_9 (Length: 323)
Name: NF20711_high_9
Description: NF20711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20711_high_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 14 - 294
Target Start/End: Complemental strand, 43315538 - 43315258
Alignment:
| Q |
14 |
gaaggagaagaaaagatcagggaaggatgataatcacattgaccatcagattagtgctccagcttttgatgatgcttggtacaaatcctatgttgctgaa |
113 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43315538 |
gaaggagaagaaaagatcagggaagaatgataatcacattgaccatcagactagtgctccagcttttgatgatgcttggtacaaatcctatgttgctgaa |
43315439 |
T |
|
| Q |
114 |
aaacagaaacagaatgagcataacaaaaatgcaatttttgtgaggtcattaagccatggcagtggcagaaagtcattgttatttggaagcaaggagatgt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
43315438 |
aaacagaaacagaatgagcataacaaaaatgcaatttttgtgaggtcattaagccatggcagtggcagaaagtcattgttatttggaagcaaagagatgt |
43315339 |
T |
|
| Q |
214 |
tggctgctgtgaagattcaaacttttttcagaggctatttggtatgtgaatatcaccaacttttgtattctaggaaagttt |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43315338 |
tggctgctgtgaagattcaaacttttttcagaggctatttggtatgtgaatgtcaccaacttttgtattctaggaaagttt |
43315258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 215 - 260
Target Start/End: Original strand, 4609107 - 4609152
Alignment:
| Q |
215 |
ggctgctgtgaagattcaaacttttttcagaggctatttggtatgt |
260 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4609107 |
ggctgctgtaaagattcaaactttcttcagaggctatttggtatgt |
4609152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University