View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20712_high_30 (Length: 241)
Name: NF20712_high_30
Description: NF20712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20712_high_30 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 5 - 223
Target Start/End: Original strand, 9135838 - 9136056
Alignment:
| Q |
5 |
ttcaaattcaaagatagaaaaatagtgttaataaagggacatgttgggagtgataaaaacttcaaacgacattcgttttaaaatggaggtagtaatcaat |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| | ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
9135838 |
ttcaaattcaaagatagaaaaatagtgttaataaagaggcatgttgggagtgataaaaaccttaaacgacgttcgttttaaaatggaggtagtaatcaat |
9135937 |
T |
 |
| Q |
105 |
gtatctagaaaattgattagaaatagaaaatgctactaagtgtccacaaaacactctttaaggaccataaagatattgttgaatgcaaaaggtacccttt |
204 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9135938 |
gtatctagaaaattgattagaaataaaaaatgctaccaagtgtccacaaaacactctttaaggaccataaagatattgttgaatgcaaaaggtacccttt |
9136037 |
T |
 |
| Q |
205 |
tcgttgttgaaggcatgag |
223 |
Q |
| |
|
||||||||||||| ||||| |
|
|
| T |
9136038 |
tcgttgttgaagggatgag |
9136056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University