View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20712_low_14 (Length: 399)
Name: NF20712_low_14
Description: NF20712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20712_low_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 2e-99; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 2e-99
Query Start/End: Original strand, 191 - 390
Target Start/End: Complemental strand, 5441577 - 5441378
Alignment:
| Q |
191 |
aaattgttattgttggctgaaaggaatgtgaatgtcacatattcatcaagtgtaataccatacaataactatgaacatatctataaagttgatagaatgg |
290 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5441577 |
aaattattattgttggctgaaaggaatgtgaatgtcacatattcatcaagtgtaataccatacaataactatgaacatatctataaagttgatagaatgg |
5441478 |
T |
|
| Q |
291 |
gtaacctcccatacctgatccaaatgaacatcactatgtagttacaacttgagaagattgatagcattcaatttgtgagtcattatctatttgcctatgc |
390 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5441477 |
gtaacctcccatacctgatccaaatgaacatcaatatgtagttacaacttgagaagatagatagcattcaatttatgagtcattatctatttgcctatgc |
5441378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 19 - 120
Target Start/End: Complemental strand, 5441751 - 5441650
Alignment:
| Q |
19 |
ctttgggtgggaaagagaaattatgtattgctggtactttaaagttgttggaccactgtcctacttctaaatgttaacactttttattttcttccaattt |
118 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
5441751 |
ctttgggtgggaaagagaaactatgtattgctggtactttaaagttgttggaccactatcctacttctaaacgttaacactttttattttcttccaattt |
5441652 |
T |
|
| Q |
119 |
tc |
120 |
Q |
| |
|
|| |
|
|
| T |
5441651 |
tc |
5441650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 136 - 167
Target Start/End: Complemental strand, 5441635 - 5441604
Alignment:
| Q |
136 |
gactatctaccaaggcaaagagaataccactc |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
5441635 |
gactatctaccaaggcaaagagaataccactc |
5441604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University