View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20713_high_11 (Length: 353)
Name: NF20713_high_11
Description: NF20713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20713_high_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 1 - 331
Target Start/End: Original strand, 5364777 - 5365107
Alignment:
| Q |
1 |
ttggtgctccttatgatcttgttatgcagactaagcaacttggaaggctgcctgttgtgcagtttgctgctggtggtgtggcgacaccggcggatgcagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
5364777 |
ttggtgctccttatgatcttgttatgcagactaagcaacttggaaggctgcctgttgtgcagtttgctgctggtggtgtggcgacaccagcggatgcagc |
5364876 |
T |
|
| Q |
101 |
tttgatgatgcagcttgggtgtgatggtgtttttgttggttctggtgtgtttaagagtggggatccggcgaaaagagcgagggcgattgttcaagctgtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5364877 |
tttgatgatgcagcttgggtgtgatggtgtttttgttggttctggtgtgtttaagagtggggatccggcgaaaagagcgagggcgattgttcaagctgtt |
5364976 |
T |
|
| Q |
201 |
actcattacagtgatcctgagattttggctgaggttagttgtggattgggtgaagccatggttgggcttaatttgactgatcataatgttgaaaggtttg |
300 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5364977 |
actcattacagtgatccagagattttggctgaggttagttgtggattgggtgaagctatggttgggcttaatttgactgatcataatgttgaaaggtttg |
5365076 |
T |
|
| Q |
301 |
ctaataggtctgaatgatttcattatcatcg |
331 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
5365077 |
ctaataggtctgaatgatttcattatcatcg |
5365107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University