View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20713_high_16 (Length: 269)
Name: NF20713_high_16
Description: NF20713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20713_high_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 236; Significance: 1e-130; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 7 - 254
Target Start/End: Complemental strand, 34672687 - 34672440
Alignment:
| Q |
7 |
gagatgaagcaatcatagaagactcagaaagccaaattttggcggcgcctttggaaagagagtcggtggattcaatatcgctgatttcgacgacgaaagc |
106 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34672687 |
gagaagaagcaatcatagaagactcagaaagccaaattttggcggtgcctttggaaagagagtcggtggattcaatatcgctgatttcgacgacgaaagc |
34672588 |
T |
|
| Q |
107 |
agattgtgaaatgaaggaagggaagattcgagaagcttcttggcagagagagacgaaatgttgtggttccgcggccgtggtgcatggtggagtggcggcg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34672587 |
agattgtgaaatgaaggaagggaagattcgagaagcttcttggcagagagagacgaaatgttgtggttccgcggccgtggtgcatggtggagtggcggcg |
34672488 |
T |
|
| Q |
207 |
gcatcgttgggaattgacgacgatgatgataaccttaattgcttcttg |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
34672487 |
gcatcgttgggaattgacgacgatgatgataaacttaattgcttcttg |
34672440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 15 - 142
Target Start/End: Original strand, 34791039 - 34791166
Alignment:
| Q |
15 |
gcaatcatagaagactcagaaagccaaattttggcggcgcctttggaaagagagtcggtggattcaatatcgctgatttcgacgacgaaagcagattgtg |
114 |
Q |
| |
|
|||| ||| ||||| ||||| |||||||||||||||||||||||||||||||| |||| |||||||| ||| | ||||| | |||| ||| || |||| |
|
|
| T |
34791039 |
gcaaccatggaagattcagagagccaaattttggcggcgcctttggaaagagaatcggcggattcaacgtcggtaatttcagcaacgagagctgaatgtg |
34791138 |
T |
|
| Q |
115 |
aaatgaaggaagggaagattcgagaagc |
142 |
Q |
| |
|
||||||| |||||||||||||||||||| |
|
|
| T |
34791139 |
aaatgaaagaagggaagattcgagaagc |
34791166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University