View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20713_high_18 (Length: 250)

Name: NF20713_high_18
Description: NF20713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20713_high_18
NF20713_high_18
[»] chr4 (1 HSPs)
chr4 (134-234)||(48682081-48682178)


Alignment Details
Target: chr4 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 134 - 234
Target Start/End: Original strand, 48682081 - 48682178
Alignment:
134 gcgtggaagagaactaactactacatacataccggtccagaaactggcttcggctttcttgtacatctcccaaagttgtttgtagcgaatagggaacata 233  Q
    ||||| ||||||||||||||    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
48682081 gcgtgaaagagaactaactag---atacgtaccggtccagaaactggcttcggctttcttgtacatctcccaaagttgtttgtagcgaacagggaacata 48682177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University