View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20714_low_3 (Length: 278)

Name: NF20714_low_3
Description: NF20714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20714_low_3
NF20714_low_3
[»] chr7 (1 HSPs)
chr7 (19-220)||(41398129-41398330)


Alignment Details
Target: chr7 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 19 - 220
Target Start/End: Complemental strand, 41398330 - 41398129
Alignment:
19 gagaatgagaggtgtttaatgtggtatgaaaattatccatggcatgtgaagattagagatggatggaaggaattcgctgcagcaagcaagtttgtgaaag 118  Q
    ||||| |||||||||||||| ||||||||| |||||||||||||||||||||||| ||||||||| ||||| || |||||| |||||||||| |||||||    
41398330 gagaacgagaggtgtttaatttggtatgaagattatccatggcatgtgaagattaaagatggatgaaaggagtttgctgcaacaagcaagttggtgaaag 41398231  T
119 gagaccggatcatcttcaacattgttaatattaattttaacaatgagattaaggtgatgaaagaaagttatttatttgaagaggatgctggtgccttttt 218  Q
    |||| | ||||||||||||||||||||| || |||| |||||||||||||||||||||||||||||| ||   || ||||||||||| ||||||||||||    
41398230 gagaacagatcatcttcaacattgttaacatcaattataacaatgagattaaggtgatgaaagaaagctacacatatgaagaggatgatggtgccttttt 41398131  T
219 gg 220  Q
    ||    
41398130 gg 41398129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University